Skip to main content

pBA950
(Plasmid #122239)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122239 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    CROPseq-Guide-Puro (Addgene, #86708)
  • Total vector size (bp) 8522
  • Modifications to backbone
    First, an intermediate vector was constructed by replacing the existing selectable marker in CROPseq-Guide-Puro with BFP (synthesized dsDNA inserted by Gibson assembly using PstI and MluI). Then pBA950 was made by replacing the entire human U6-driven sgRNA expression cassette with the sgRNA expression cassette from pU6-sgRNA EF1Alpha-puro-T2A-BFP (synthesized dsDNA inserted between PpuMI and NcoI by Gibson assembly). This cassette is driven by a modified mouse U6 promoter and encodes a BlpI-containing sgRNA(F+E) programmed with EGFP-NT2.
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    BFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BFP selectable marker, plus a modified mU6 promoter and sgRNA constant region for optimized CRISPRi activity
  • gRNA/shRNA sequence
    EGFP-NT2
  • Species
    Synthetic

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cagcacaaaaggaaactcacc
  • 3′ sequencing primer TCAAGTTGATAACGGACTAGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBA950 was a gift from Jonathan Weissman (Addgene plasmid # 122239 ; http://n2t.net/addgene:122239 ; RRID:Addgene_122239)
  • For your References section:

    Combinatorial single-cell CRISPR screens by direct guide RNA capture and targeted sequencing. Replogle JM, Norman TM, Xu A, Hussmann JA, Chen J, Cogan JZ, Meer EJ, Terry JM, Riordan DP, Srinivas N, Fiddes IT, Arthur JG, Alvarado LJ, Pfeiffer KA, Mikkelsen TS, Weissman JS, Adamson B. Nat Biotechnol. 2020 Aug;38(8):954-961. doi: 10.1038/s41587-020-0470-y. Epub 2020 Mar 30. 10.1038/s41587-020-0470-y PubMed 32231336