pMB4
(Plasmid
#122246)
-
Purpose(Empty Backbone) Lentivirus delivery for stable expression of As crRNA, has AsDR; Cloning vector for expression of AsCpf1 crRNA. It contains BsmBI site for cloning.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122246 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO
- Backbone size (bp) 7500
-
Vector typeLentiviral
-
Selectable markersBlasticidin ; GFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 3′ sequencing primer ccagtacacgacatcactttcc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMB4 was a gift from Darjus Tschaharganeh (Addgene plasmid # 122246 ; http://n2t.net/addgene:122246 ; RRID:Addgene_122246) -
For your References section:
Multiplexed orthogonal genome editing and transcriptional activation by Cas12a. Breinig M, Schweitzer AY, Herianto AM, Revia S, Schaefer L, Wendler L, Cobos Galvez A, Tschaharganeh DF. Nat Methods. 2019 Jan;16(1):51-54. doi: 10.1038/s41592-018-0262-1. Epub 2018 Dec 17. 10.1038/s41592-018-0262-1 [pii] PubMed 30559432