pBbE2k-pTet-gRNAwcaF159
(Plasmid
#122259)
-
PurposeaTc inducible gRNA expression plasmid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122259 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBbE2k
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namegRNAwcaF159
-
gRNA/shRNA sequenceCGTTTATTCGGAGCAAAAAT
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer Unknown
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBbE2k-pTet-gRNAwcaF159 was a gift from Chueh Loo Poh (Addgene plasmid # 122259 ; http://n2t.net/addgene:122259 ; RRID:Addgene_122259) -
For your References section:
Regulating exopolysaccharide gene wcaF allows control of Escherichia coli biofilm formation. Zhang J, Poh CL. Sci Rep. 2018 Sep 3;8(1):13127. doi: 10.1038/s41598-018-31161-7. 10.1038/s41598-018-31161-7 PubMed 30177768