Skip to main content

pcDNA3.1-3xFLAG-RSL1D1(WT)
(Plasmid #122301)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122301 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5450
  • Total vector size (bp) 6950
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RSL1D1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1560
  • GenBank ID
    NM_015659
  • Entrez Gene
    RSL1D1 (a.k.a. CSIG, L12, PBK1, UTP30)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer T7: TAATACGACTCACTATAGGG
  • 3′ sequencing primer SP6: ATTTAGGTGACACTATAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-3xFLAG-RSL1D1(WT) was a gift from Gerardo Ferbeyre (Addgene plasmid # 122301 ; http://n2t.net/addgene:122301 ; RRID:Addgene_122301)
  • For your References section:

    Senescence-associated ribosome biogenesis defects contributes to cell cycle arrest through the Rb pathway. Lessard F, Igelmann S, Trahan C, Huot G, Saint-Germain E, Mignacca L, Del Toro N, Lopes-Paciencia S, Le Calve B, Montero M, Deschenes-Simard X, Bury M, Moiseeva O, Rowell MC, Zorca CE, Zenklusen D, Brakier-Gingras L, Bourdeau V, Oeffinger M, Ferbeyre G. Nat Cell Biol. 2018 Jul;20(7):789-799. doi: 10.1038/s41556-018-0127-y. Epub 2018 Jun 25. 10.1038/s41556-018-0127-y PubMed 29941930