Skip to main content

pX330-LMNA-gRNA1
(Plasmid #122507)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122507 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330 (Plasmid #42230)
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 8484
  • Total vector size (bp) 8504
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LMNA-gRNA1
  • gRNA/shRNA sequence
    GGTTGGCAGCGCTGCCCGCG
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bbs1 (destroyed during cloning)
  • 3′ cloning site Bbs1 (destroyed during cloning)
  • 5′ sequencing primer hU6-F
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-LMNA-gRNA1 was a gift from Graham Dellaire (Addgene plasmid # 122507 ; http://n2t.net/addgene:122507 ; RRID:Addgene_122507)
  • For your References section:

    Nuclear domain 'knock-in' screen for the evaluation and identification of small molecule enhancers of CRISPR-based genome editing. Pinder J, Salsman J, Dellaire G. Nucleic Acids Res. 2015 Oct 30;43(19):9379-92. doi: 10.1093/nar/gkv993. Epub 2015 Oct 1. 10.1093/nar/gkv993 PubMed 26429972