-
Purposeexpresses WT spCas9 and a chimeric gRNA targeting human LMNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122507 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX330 (Plasmid #42230)
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 8484
- Total vector size (bp) 8504
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLMNA-gRNA1
-
gRNA/shRNA sequenceGGTTGGCAGCGCTGCCCGCG
-
SpeciesH. sapiens (human)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bbs1 (destroyed during cloning)
- 3′ cloning site Bbs1 (destroyed during cloning)
- 5′ sequencing primer hU6-F (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-LMNA-gRNA1 was a gift from Graham Dellaire (Addgene plasmid # 122507 ; http://n2t.net/addgene:122507 ; RRID:Addgene_122507) -
For your References section:
Nuclear domain 'knock-in' screen for the evaluation and identification of small molecule enhancers of CRISPR-based genome editing. Pinder J, Salsman J, Dellaire G. Nucleic Acids Res. 2015 Oct 30;43(19):9379-92. doi: 10.1093/nar/gkv993. Epub 2015 Oct 1. 10.1093/nar/gkv993 PubMed 26429972