pET15b-His-3C-irisin
(Plasmid
#122612)
-
PurposeExpresses in E. coli: human irisin with Nt histag and 3C protease site for cleavage
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122612 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET15b
-
Backbone manufacturernovagen
- Total vector size (bp) 2718
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsUse C41(DE3) strain for expression. It will give higher expression than BL21(DE3).
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameirisin (ectodomain of FNDC5)
-
Alt nameFNDC5
-
SpeciesH. sapiens (human), M. musculus (mouse), R. norvegicus (rat), B. taurus (bovine)
-
Insert Size (bp)426
-
GenBank IDNM_027402.3
-
Entrez GeneFndc5 (a.k.a. 1500001L03Rik, PeP, Pxp)
- Promoter T7 polymerase
-
Tag
/ Fusion Protein
- Nt: histag-3C protease site (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer T7 promotor primer TAATACGACTCACTATAGGG
- 3′ sequencing primer T7 terminator primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET15b-His-3C-irisin was a gift from Harold Erickson (Addgene plasmid # 122612 ; http://n2t.net/addgene:122612 ; RRID:Addgene_122612) -
For your References section:
Irisin - a myth rather than an exercise-inducible myokine. Albrecht E, Norheim F, Thiede B, Holen T, Ohashi T, Schering L, Lee S, Brenmoehl J, Thomas S, Drevon CA, Erickson HP, Maak S. Sci Rep. 2015 Mar 9;5:8889. doi: 10.1038/srep08889. 10.1038/srep08889 PubMed 25749243