Skip to main content

HA-hNPHP1
(Plasmid #122872)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122872 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCS2+HA
  • Backbone size w/o insert (bp) 4100
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human NPHP1
  • Species
    H. sapiens (human)
  • Entrez Gene
    NPHP1 (a.k.a. JBTS4, NPH1, SLSN1)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GCGTGCCTAATGGGAGGTCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HA-hNPHP1 was a gift from FENG-QIAN Li & Ken-Ichi Takemaru (Addgene plasmid # 122872 ; http://n2t.net/addgene:122872 ; RRID:Addgene_122872)
  • For your References section:

    CEP164 is essential for efferent duct multiciliogenesis and male fertility. Hoque M, Chen D, Hess RA, Li FQ, Takemaru KI. Reproduction. 2021 Jul 8;162(2):129-139. doi: 10.1530/REP-21-0042. 10.1530/REP-21-0042 PubMed 34085951