-
PurposeLenti plasmid containing a CDH5 promoter driving GFP followed by T2A and an antibiotic resistance cassette (zeocin). Used for selection of endothelial cells.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122970 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti6⁄V5-DEST™ Gateway® Vector
-
Backbone manufacturerThermoFisher Scientific
- Total vector size (bp) 10066
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCDH5p
-
Alt nameCDH5 promoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1500
-
MutationNA
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer TTCAGACCTGGAGGAGGAGATA
- 3′ sequencing primer AGATCAGCGGCCGCTTGCTG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCopGFP
-
Alt namegreen fluorescent protein cloned from copepod
-
SpeciesCopepod
-
Insert Size (bp)650
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer TTCAGACCTGGAGGAGGAGATA
- 3′ sequencing primer AGATCAGCGGCCGCTTGCTG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameZeocin
-
SpeciesAntibiotic Resistance Cassette
-
Insert Size (bp)400
-
MutationNA
Cloning Information for Gene/Insert 3
- Cloning method Gateway Cloning
- 5′ sequencing primer TTCAGACCTGGAGGAGGAGATA
- 3′ sequencing primer AGATCAGCGGCCGCTTGCTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CDH5-AbR-GFP was a gift from Budd A. Tucker (Addgene plasmid # 122970 ; http://n2t.net/addgene:122970 ; RRID:Addgene_122970)