Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #51543)


Item Catalog # Description Quantity Price (USD)
Plasmid 51543 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    MYC (a.k.a. MRTL, MYCC, bHLHe39, c-Myc)
  • Entrez Gene
    KLF4 (a.k.a. EZF, GKLF)
  • Entrez Gene
    SOX2 (a.k.a. ANOP3, MCOPS3)
  • Entrez Gene
    POU5F1 (a.k.a. OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)
  • Promoter tetO

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer agagctcgtttagtgaaccg
  • 3′ sequencing primer gttgcgtcagcaaacacagt
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    the FUW backbone comes from Plasmid 20724: FUW-tetO-hSOX2 the hOKMS insert comes from Plasmid 27512: pLM-fSV2A
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FUW-tetO-hOKMS was a gift from Tarjei Mikkelsen (Addgene plasmid # 51543 ; ; RRID:Addgene_51543)
  • For your References section:

    Integrative Analyses of Human Reprogramming Reveal Dynamic Nature of Induced Pluripotency. Cacchiarelli D, Trapnell C, Ziller MJ, Soumillon M, Cesana M, Karnik R, Donaghey J, Smith ZD, Ratanasirintrawoot S, Zhang X, Ho Sui SJ, Wu Z, Akopian V, Gifford CA, Doench J, Rinn JL, Daley GQ, Meissner A, Lander ES, Mikkelsen TS. Cell. 2015 Jul 16;162(2):412-24. doi: 10.1016/j.cell.2015.06.016. 10.1016/j.cell.2015.06.016 PubMed 26186193