pBLO2 casX
(Plasmid
#123122)
-
PurposeE. coli expression vector for CasX sgRNA
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 123122 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneNA
- Total vector size (bp) 2311
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCasX guide RNA
-
gRNA/shRNA sequenceCTGGAGTTGTCCCAATTCTT
-
SpeciesDeltaproteobacteria
-
Insert Size (bp)2955
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBLO2 casX was a gift from Jennifer Doudna & Benjamin Oakes (Addgene plasmid # 123122 ; http://n2t.net/addgene:123122 ; RRID:Addgene_123122) -
For your References section:
CasX enzymes comprise a distinct family of RNA-guided genome editors. Liu JJ, Orlova N, Oakes BL, Ma E, Spinner HB, Baney KLM, Chuck J, Tan D, Knott GJ, Harrington LB, Al-Shayeb B, Wagner A, Brotzmann J, Staahl BT, Taylor KL, Desmarais J, Nogales E, Doudna JA. Nature. 2019 Feb 4. pii: 10.1038/s41586-019-0908-x. doi: 10.1038/s41586-019-0908-x. 10.1038/s41586-019-0908-x PubMed 30718774