Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Cx36-GCaMP
(Plasmid #123604)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 123604 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3800
  • Total vector size (bp) 6335
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Connexin 36-GCaMP3 fusion
  • Alt name
    Cx36-GCaMP
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2513
  • Entrez Gene
    Gjd2 (a.k.a. Cxns, Gja9, connexin36, cx36)
  • Promoter CMV
  • Tag / Fusion Protein
    • GCaMP3 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AfeI (destroyed during cloning)
  • 3′ cloning site BglII (destroyed during cloning)
  • 5′ sequencing primer CMV forward (CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer GCaMP Rev (TGATGCCGTTCTTCTGCTTGTC)
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Muayyad Al-Ubaidi, University of Illinois, Chicago (currently University of Houston) GCaMP3 from Loren Looger (Addgene plasmid #22692)
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cx36-GCaMP was a gift from John O'Brien (Addgene plasmid # 123604 ; http://n2t.net/addgene:123604 ; RRID:Addgene_123604)
  • For your References section:

    Localized calcium signaling and the control of coupling at Cx36 gap junctions. Moore KB, Mitchell CK, Lin YP, Lee YH, Shihabeddin E, O'Brien J. eNeuro. 2020 Mar 11. pii: ENEURO.0445-19.2020. doi: 10.1523/ENEURO.0445-19.2020. 10.1523/ENEURO.0445-19.2020 PubMed 32179580