pKM19
(Plasmid
#123655)
-
PurposeEncodes firefly luciferase under the pIEx promoter for constitutive expression in insect (e.g. Drosophila, mosquito) cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 123655 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepIEx
- Backbone size w/o insert (bp) 3639
- Total vector size (bp) 5337
-
Vector typeInsect Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFirefly luciferase
-
SpeciesPhotinus pyralis (firefly)
-
Insert Size (bp)1698
- Promoter pIEx
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GATAACCGCGTTGGTTTTA
- 3′ sequencing primer CCAACTCCCATTGTTATTTCTATGCA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypLUC-MCS vector (Agilent Technologies, Santa Clara, CA USA) and pIEx-EGFP (Doug Brackney, The Connecticut Agricultural Experiment Station, New Haven, CT USA)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The constitutive firefly luciferase expression plasmid pKM19 was generated by amplifying the firefly luciferase gene from pLUC-MCS and cloning it into pIEx-EGFP (a kind gift from Doug Brackney, The Connecticut Agricultural Experiment Station, New Haven, CT USA) after the EGFP sequence was removed by digestion with XhoI and NcoI, using In-Fusion cloning (Takara Biosciences, Mountain View, CA USA).
Please visit https://www.biorxiv.org/content/10.1101/596205v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKM19 was a gift from Kevin Maringer (Addgene plasmid # 123655 ; http://n2t.net/addgene:123655 ; RRID:Addgene_123655) -
For your References section:
Aedes aegypti (Aag2)-derived clonal mosquito cell lines reveal the effects of pre-existing persistent infection with the insect-specific bunyavirus Phasi Charoen-like virus on arbovirus replication. Fredericks AC, Russell TA, Wallace LE, Davidson AD, Fernandez-Sesma A, Maringer K. PLoS Negl Trop Dis. 2019 Nov 6;13(11):e0007346. doi: 10.1371/journal.pntd.0007346. eCollection 2019 Nov. 10.1371/journal.pntd.0007346 PubMed 31693659