Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSLQ7748 mU6: Spy sgTET || CMV: mCherry~P2A-DD-A4
(Plasmid #123657)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 123657 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHR
  • Backbone size w/o insert (bp) 6835
  • Total vector size (bp) 8307
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry-P2A-DD-AcrIIA4
  • Species
    Synthetic
  • Insert Size (bp)
    1368
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry-P2A (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGGTTTAGTGAACCGTC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ7748 mU6: Spy sgTET || CMV: mCherry~P2A-DD-A4 was a gift from Stanley Qi (Addgene plasmid # 123657 ; http://n2t.net/addgene:123657 ; RRID:Addgene_123657)
  • For your References section:

    Anti-CRISPR-mediated control of gene editing and synthetic circuits in eukaryotic cells. Nakamura M, Srinivasan P, Chavez M, Carter MA, Dominguez AA, La Russa M, Lau MB, Abbott TR, Xu X, Zhao D, Gao Y, Kipniss NH, Smolke CD, Bondy-Denomy J, Qi LS. Nat Commun. 2019 Jan 14;10(1):194. doi: 10.1038/s41467-018-08158-x. 10.1038/s41467-018-08158-x [pii] PubMed 30643127