pSLQ7748 mU6: Spy sgTET || CMV: mCherry~P2A-DD-A4
(Plasmid
#123657)
-
PurposeDD-AcrIIA4 fusion for Shield1-mediated AcrIIA4 control with sgRNA driving TRE3G activation.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 123657 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHR
- Backbone size w/o insert (bp) 6835
- Total vector size (bp) 8307
-
Vector typeMammalian Expression, Lentiviral, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry-P2A-DD-AcrIIA4
-
SpeciesSynthetic
-
Insert Size (bp)1368
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry-P2A (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGGTTTAGTGAACCGTC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ7748 mU6: Spy sgTET || CMV: mCherry~P2A-DD-A4 was a gift from Stanley Qi (Addgene plasmid # 123657 ; http://n2t.net/addgene:123657 ; RRID:Addgene_123657) -
For your References section:
Anti-CRISPR-mediated control of gene editing and synthetic circuits in eukaryotic cells. Nakamura M, Srinivasan P, Chavez M, Carter MA, Dominguez AA, La Russa M, Lau MB, Abbott TR, Xu X, Zhao D, Gao Y, Kipniss NH, Smolke CD, Bondy-Denomy J, Qi LS. Nat Commun. 2019 Jan 14;10(1):194. doi: 10.1038/s41467-018-08158-x. 10.1038/s41467-018-08158-x [pii] PubMed 30643127