Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSLHDR03_mCherry_tCD19_unique guide
(Plasmid #124062)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 124062 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Original
  • Backbone size w/o insert (bp) 2541
  • Total vector size (bp) 5865
  • Vector type
    Mouse Targeting ; Human Targeting
  • Selectable markers
    mCherry, tCD19

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    708
  • Promoter Human UbC modified

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCCCACAACGAGGACTACAC
  • 3′ sequencing primer ccctcATTCTTGGGGTTGAGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    tCD19
  • Species
    Synthetic
  • Insert Size (bp)
    1002
  • Promoter Human UbC modified

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAGTGTTAGACTAGTAAATTGTCCGC
  • 3′ sequencing primer CTCCCACAACGAGGACTACAC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLHDR03_mCherry_tCD19_unique guide was a gift from Matthew Porteus (Addgene plasmid # 124062 ; http://n2t.net/addgene:124062 ; RRID:Addgene_124062)
  • For your References section:

    Efficient scarless genome editing in human pluripotent stem cells. Ikeda K, Uchida N, Nishimura T, White J, Martin RM, Nakauchi H, Sebastiano V, Weinberg KI, Porteus MH. Nat Methods. 2018 Dec;15(12):1045-1047. doi: 10.1038/s41592-018-0212-y. Epub 2018 Nov 30. 10.1038/s41592-018-0212-y PubMed 30504872