Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

KA0637_pPBCAG-rtTAM2-IN
(Plasmid #124166)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 124166 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Unknown
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rtTAM2-IRES-Neo
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer TCTGCTAACCATGTTCATGC
  • 3′ sequencing primer TATAGACAAACGCACACCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    KA0637_pPBCAG-rtTAM2-IN was a gift from Hans Schöler (Addgene plasmid # 124166 ; http://n2t.net/addgene:124166 ; RRID:Addgene_124166)
  • For your References section:

    Esrrb Unlocks Silenced Enhancers for Reprogramming to Naive Pluripotency. Adachi K, Kopp W, Wu G, Heising S, Greber B, Stehling M, Arauzo-Bravo MJ, Boerno ST, Timmermann B, Vingron M, Scholer HR. Cell Stem Cell. 2018 Aug 2;23(2):266-275.e6. doi: 10.1016/j.stem.2018.05.020. Epub 2018 Jun 14. 10.1016/j.stem.2018.05.020 PubMed 29910149