Skip to main content

hKCNB1 F416L
(Plasmid #124491)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124491 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 124491-D50 50 μg of DNA in Tris buffer $495
DNA 124491-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pHA-CIneo (Promega’s pCI-neo vector modified with a HA-tag)
  • Backbone manufacturer
    promega
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    human KCNB1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2578
  • Mutation
    changed phenyalanine 416 to leucine
  • Entrez Gene
    KCNB1 (a.k.a. DRK1, Kv2.1)
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer agctgaattccaccatgccggcgggcatgacg
  • 3′ sequencing primer TGGGTAGAATTCGATGCTCTGATCTCGTGTGCTTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hKCNB1 F416L was a gift from Federico Sesti (Addgene plasmid # 124491 ; http://n2t.net/addgene:124491 ; RRID:Addgene_124491)
  • For your References section:

    Complexes formed with integrin-alpha5 and KCNB1 potassium channel wild type or epilepsy-susceptibility variants modulate cellular plasticity via Ras and Akt signaling. Yu W, Shin MR, Sesti F. FASEB J. 2019 Dec;33(12):14680-14689. doi: 10.1096/fj.201901792R. Epub 2019 Nov 2. 10.1096/fj.201901792R PubMed 31682765