pX330-NL-DHFR-SpCas9
(Plasmid
#124522)
-
PurposeExpresses SpCas9 fused to DHFR domains on both the N-terminus and an internal loop in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124522 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX330
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 9976
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNL-DHFR-SpCas9
-
SpeciesS. pyogenes
-
Insert Size (bp)5199
- Promoter Cbh
-
Tags
/ Fusion Proteins
- Destabilized domain of E.coli dihydrofolate reductase (N terminal on insert)
- Destabilized domain of E.coli dihydrofolate reductase (internal loop at amino acid 231)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cacctgcctgaaatcactttt
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-NL-DHFR-SpCas9 was a gift from Amit Choudhary (Addgene plasmid # 124522 ; http://n2t.net/addgene:124522 ; RRID:Addgene_124522) -
For your References section:
A Singular System with Precise Dosing and Spatiotemporal Control of CRISPR-Cas9. Manna D, Maji B, Gangopadhyay SA, Cox KJ, Zhou Q, Law BK, Mazitschek R, Choudhary A. Angew Chem Int Ed Engl. 2019 May 6;58(19):6285-6289. doi: 10.1002/anie.201900788. Epub 2019 Apr 2. 10.1002/anie.201900788 PubMed 30834641