Skip to main content
Addgene

pX330-NLC-DHFR-SpCas9
(Plasmid #124523)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124523 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 9976
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NLC-DHFR-SpCas9
  • Species
    S. pyogenes
  • Insert Size (bp)
    5673
  • Promoter Cbh
  • Tags / Fusion Proteins
    • Destabilized domain of E.coli dihydrofolate reductase (N terminal on insert)
    • Destabilized domain of E.coli dihydrofolate reductase (C terminal on insert)
    • Destabilized domain of E.coli dihydrofolate reductase (internal loop at amino acid 231)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cacctgcctgaaatcactttt
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-NLC-DHFR-SpCas9 was a gift from Amit Choudhary (Addgene plasmid # 124523 ; http://n2t.net/addgene:124523 ; RRID:Addgene_124523)
  • For your References section:

    A Singular System with Precise Dosing and Spatiotemporal Control of CRISPR-Cas9. Manna D, Maji B, Gangopadhyay SA, Cox KJ, Zhou Q, Law BK, Mazitschek R, Choudhary A. Angew Chem Int Ed Engl. 2019 May 6;58(19):6285-6289. doi: 10.1002/anie.201900788. Epub 2019 Apr 2. 10.1002/anie.201900788 PubMed 30834641