pTEF6-7
(Plasmid
#124583)
-
PurposeReporter plasmid with constitutively expressed mCherry and YFP (eCitrine)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124583 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep416
-
Vector typeYeast Expression
-
Selectable markersNeomycin (select with G418), URA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer ATTAGGTACCCGAGCTCTCGAGAACCCTTAATATAACTT
- 3′ sequencing primer ATATGGTACCAGCGTACGAGCGACCTCATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/682302v1 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTEF6-7 was a gift from Matthias Heinemann (Addgene plasmid # 124583 ; http://n2t.net/addgene:124583 ; RRID:Addgene_124583) -
For your References section:
Measuring glycolytic flux in single yeast cells with an orthogonal synthetic biosensor. Monteiro F, Hubmann G, Takhaveev V, Vedelaar SR, Norder J, Hekelaar J, Saldida J, Litsios A, Wijma HJ, Schmidt A, Heinemann M. Mol Syst Biol. 2019 Dec;15(12):e9071. doi: 10.15252/msb.20199071. 10.15252/msb.20199071 PubMed 31885198