pAAV-EF1a-DIO-FLPo-Myc
(Plasmid
#124641)
-
PurposeAAV-mediated Cre-dependent expression of FLPo recombinase under EF1a promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124641 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAAV-Ef1a-DIO
-
Backbone manufacturerKarl Deisseroth (pAAV-Ef1a-DIO-hChR2(E123T/T159C)-mCherry, Addgene 35510)
- Backbone size w/o insert (bp) 5603
- Total vector size (bp) 6932
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFLPo
-
Alt nameFLP
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1329
- Promoter EF1a
-
Tag
/ Fusion Protein
- myc tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CACCCACACAAAGGAAAAGGGCC
- 3′ sequencing primer GCAATAGCATGATACAAAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1a-DIO-FLPo-Myc was a gift from David Dupret (Addgene plasmid # 124641 ; http://n2t.net/addgene:124641 ; RRID:Addgene_124641) -
For your References section:
A Hippocampus-Accumbens Tripartite Neuronal Motif Guides Appetitive Memory in Space. Trouche S, Koren V, Doig NM, Ellender TJ, El-Gaby M, Lopes-Dos-Santos V, Reeve HM, Perestenko PV, Garas FN, Magill PJ, Sharott A, Dupret D. Cell. 2019 Mar 7;176(6):1393-1406.e16. doi: 10.1016/j.cell.2018.12.037. Epub 2019 Feb 14. 10.1016/j.cell.2018.12.037 PubMed 30773318