Skip to main content

pAAV-CaMKII-EGFPKASH
(Plasmid #124882)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124882 Standard format: Plasmid sent in bacteria as agar stab 1 $94

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-CaMKII-EGFP
  • Backbone manufacturer
    Addgene#50469
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EGFP
  • Promoter CaMKII
  • Tag / Fusion Protein
    • KASH (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer AAGGACGACGGCAACTACAA
  • 3′ sequencing primer CAGAGGTTGATTATCGATAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

bioRxiv pre-print 10.1101/579250

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKII-EGFPKASH was a gift from Vassilis Pachnis (Addgene plasmid # 124882 ; http://n2t.net/addgene:124882 ; RRID:Addgene_124882)
  • For your References section:

    Neuronal programming by microbiota regulates intestinal physiology. Obata Y, Castano A, Boeing S, Bon-Frauches AC, Fung C, Fallesen T, de Aguero MG, Yilmaz B, Lopes R, Huseynova A, Horswell S, Maradana MR, Boesmans W, Vanden Berghe P, Murray AJ, Stockinger B, Macpherson AJ, Pachnis V. Nature. 2020 Feb;578(7794):284-289. doi: 10.1038/s41586-020-1975-8. Epub 2020 Feb 5. 10.1038/s41586-020-1975-8 PubMed 32025031