-
Purposelabelling of neuronal nuclear envelope with EGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124882 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-CaMKII-EGFP
-
Backbone manufacturerAddgene#50469
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEGFP
- Promoter CaMKII
-
Tag
/ Fusion Protein
- KASH (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer AAGGACGACGGCAACTACAA
- 3′ sequencing primer CAGAGGTTGATTATCGATAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
bioRxiv pre-print 10.1101/579250
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CaMKII-EGFPKASH was a gift from Vassilis Pachnis (Addgene plasmid # 124882 ; http://n2t.net/addgene:124882 ; RRID:Addgene_124882) -
For your References section:
Neuronal programming by microbiota regulates intestinal physiology. Obata Y, Castano A, Boeing S, Bon-Frauches AC, Fung C, Fallesen T, de Aguero MG, Yilmaz B, Lopes R, Huseynova A, Horswell S, Maradana MR, Boesmans W, Vanden Berghe P, Murray AJ, Stockinger B, Macpherson AJ, Pachnis V. Nature. 2020 Feb;578(7794):284-289. doi: 10.1038/s41586-020-1975-8. Epub 2020 Feb 5. 10.1038/s41586-020-1975-8 PubMed 32025031