pcDNA-FLAG-MYO1D
(Plasmid
#125125)
-
PurposeExpresses human FLAG-MYO1D
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 125125 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA6
- Backbone size w/o insert (bp) 5090
- Total vector size (bp) 8096
-
Modifications to backboneFLAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMYO1D
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3018
-
GenBank IDNM_015194.3
-
Entrez GeneMYO1D (a.k.a. PPP1R108, myr4)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byOrigene
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA-FLAG-MYO1D was a gift from Bruce Beutler (Addgene plasmid # 125125 ; http://n2t.net/addgene:125125 ; RRID:Addgene_125125) -
For your References section:
The class I myosin MYO1D binds to lipid and protects against colitis. McAlpine W, Wang KW, Choi JH, San Miguel M, McAlpine SG, Russell J, Ludwig S, Li X, Tang M, Zhan X, Choi M, Wang T, Bu CH, Murray AR, Moresco EMY, Turer EE, Beutler B. Dis Model Mech. 2018 Sep 27;11(9). pii: 11/9/dmm035923. doi: 10.1242/dmm.035923. 10.1242/dmm.035923 PubMed 30279225