pFB1.HMBP.PrS.SUZ12
(Plasmid
#125162)
-
PurposeExpresses human SUZ12 in insect cells, , under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 125162 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepFB1.HMBP.A3.PrS.ybbR
- Backbone size w/o insert (bp) 5986
-
Modifications to backboneN-terminal His-MBP PreScission cleavage site
-
Vector typeInsect Expression ; baculovirus expression vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePolycomb protein SUZ12
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2220
-
GenBank ID23512 23512
-
Entrez GeneSUZ12 (a.k.a. CHET9, IMMAS, JJAZ1)
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- His-MBP (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer U003F pFB1 GGATTATTCATACCGTCCCA
- 3′ sequencing primer U004 [Univ. pFB1/pFBD[PH] R] CAAATGTGGTATGGCTGATT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFB1.HMBP.PrS.SUZ12 was a gift from Chen Davidovich (Addgene plasmid # 125162 ; http://n2t.net/addgene:125162 ; RRID:Addgene_125162) -
For your References section:
RNA exploits an exposed regulatory site to inhibit the enzymatic activity of PRC2. Zhang Q, McKenzie NJ, Warneford-Thomson R, Gail EH, Flanigan SF, Owen BM, Lauman R, Levina V, Garcia BA, Schittenhelm RB, Bonasio R, Davidovich C. Nat Struct Mol Biol. 2019 Mar;26(3):237-247. doi: 10.1038/s41594-019-0197-y. Epub 2019 Mar 4. 10.1038/s41594-019-0197-y PubMed 30833789