-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 12552 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepKmyc
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameExportin-5
-
Alt nameEXP5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3600
-
MutationNone
-
GenBank IDNM_020750
-
Entrez GeneXPO5 (a.k.a. exp5)
-
Tag
/ Fusion Protein
- Myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (destroyed during cloning)
- 3′ cloning site BamH1 (destroyed during cloning)
- 5′ sequencing primer CAGGTCCAACTGCACCTCGGTTC
- 3′ sequencing primer TTTGTGATGCTATTGCTTTATTTGTA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKmyc-Exp5 was a gift from Ian Macara (Addgene plasmid # 12552 ; http://n2t.net/addgene:12552 ; RRID:Addgene_12552) -
For your References section:
Exportin-5, a novel karyopherin, mediates nuclear export of double-stranded RNA binding proteins. Brownawell AM, Macara IG. J Cell Biol. 2002 Jan 7. 156(1):53-64. 10.1083/jcb.200110082 PubMed 11777942