-
Depositing Lab
-
Depositing OrganizationUniversity of Virginia
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 12552 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 12552-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 12552-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepKmyc
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameExportin-5
-
Alt nameEXP5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3600
-
MutationNone
-
GenBank IDNM_020750
-
Entrez GeneXPO5 (a.k.a. exp5)
-
Tag
/ Fusion Protein
- Myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (destroyed during cloning)
- 3′ cloning site BamH1 (destroyed during cloning)
- 5′ sequencing primer CAGGTCCAACTGCACCTCGGTTC
- 3′ sequencing primer TTTGTGATGCTATTGCTTTATTTGTA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 12552-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 12552-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKmyc-Exp5 was a gift from Ian Macara (Addgene plasmid # 12552 ; http://n2t.net/addgene:12552 ; RRID:Addgene_12552) -
For your References section:
Exportin-5, a novel karyopherin, mediates nuclear export of double-stranded RNA binding proteins. Brownawell AM, Macara IG. J Cell Biol. 2002 Jan 7. 156(1):53-64. 10.1083/jcb.200110082 PubMed 11777942