Skip to main content
Addgene
Open Menu

pXPR_BRD051-sgMLH1-1
(Plasmid #125776)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125776 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 125776-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 125776-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pXPR_BRD051
  • Backbone size w/o insert (bp) 13477
  • Vector type
    CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgMLH1-1
  • gRNA/shRNA sequence
    TTTGGCCAGCATAAGCCATG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    25
  • Entrez Gene
    MLH1 (a.k.a. COCA2, FCC2, HNPCC, HNPCC2, LYNCH2, MLH-1, MMRCS1, hMLH1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/502070v1 for BioRxiv preprint.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR_BRD051-sgMLH1-1 was a gift from Francisca Vazquez (Addgene plasmid # 125776 ; http://n2t.net/addgene:125776 ; RRID:Addgene_125776)

  • For your References section:

    WRN helicase is a synthetic lethal target in microsatellite unstable cancers. Chan EM, Shibue T, McFarland JM, Gaeta B, Ghandi M, Dumont N, Gonzalez A, McPartlan JS, Li T, Zhang Y, Bin Liu J, Lazaro JB, Gu P, Piett CG, Apffel A, Ali SO, Deasy R, Keskula P, Ng RWS, Roberts EA, Reznichenko E, Leung L, Alimova M, Schenone M, Islam M, Maruvka YE, Liu Y, Roper J, Raghavan S, Giannakis M, Tseng YY, Nagel ZD, D'Andrea A, Root DE, Boehm JS, Getz G, Chang S, Golub TR, Tsherniak A, Vazquez F, Bass AJ. Nature. 2019 Apr 10. pii: 10.1038/s41586-019-1102-x. doi: 10.1038/s41586-019-1102-x. 10.1038/s41586-019-1102-x PubMed 30971823
Related items:
Commonly requested with: