Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pXPR_BRD051-sgMLH1-1
(Plasmid #125776)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 125776 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pXPR_BRD051
  • Backbone size w/o insert (bp) 13477
  • Vector type
    CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgMLH1-1
  • gRNA/shRNA sequence
    TTTGGCCAGCATAAGCCATG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    25
  • Entrez Gene
    MLH1 (a.k.a. COCA2, FCC2, HNPCC, HNPCC2, hMLH1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/502070v1 for BioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR_BRD051-sgMLH1-1 was a gift from Francisca Vazquez (Addgene plasmid # 125776 ; http://n2t.net/addgene:125776 ; RRID:Addgene_125776)
  • For your References section:

    WRN helicase is a synthetic lethal target in microsatellite unstable cancers. Chan EM, Shibue T, McFarland JM, Gaeta B, Ghandi M, Dumont N, Gonzalez A, McPartlan JS, Li T, Zhang Y, Bin Liu J, Lazaro JB, Gu P, Piett CG, Apffel A, Ali SO, Deasy R, Keskula P, Ng RWS, Roberts EA, Reznichenko E, Leung L, Alimova M, Schenone M, Islam M, Maruvka YE, Liu Y, Roper J, Raghavan S, Giannakis M, Tseng YY, Nagel ZD, D'Andrea A, Root DE, Boehm JS, Getz G, Chang S, Golub TR, Tsherniak A, Vazquez F, Bass AJ. Nature. 2019 Apr 10. pii: 10.1038/s41586-019-1102-x. doi: 10.1038/s41586-019-1102-x. 10.1038/s41586-019-1102-x PubMed 30971823