-
PurposeEfficient expression of tRNA synthetase/tRNA for the incorporation of a photo-cross-linker, 3’-azibutyl-N-carbamoyl-lysine (AbK) into recombinant protein by amber codon (TAG) suppression in E. coli.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126035 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep15A
- Backbone size w/o insert (bp) 4200
- Total vector size (bp) 6801
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsBL21(DE3) strain can be used for the protein expression.
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nametRNA synthetase 1
-
SpeciesM. barkeri
-
Insert Size (bp)1260
-
MutationL274M, C313A, Y349F
- Promoter araBAD promoter
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nametRNA synthetase 2
-
SpeciesM. barkeri
-
Insert Size (bp)1260
-
MutationL274M, C313A, Y349F
- Promoter glnS promoter
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer CGAGAGTAGGGAACTGCCAG
- 3′ sequencing primer CGCTGAACGCGGCGTTTTGG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nametRNA for TAG codon
-
SpeciesSynthetic
-
Insert Size (bp)72
- Promoter proK promoter
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer not necessary
- 3′ sequencing primer CAACAGTACTGCGATGAGTGGCAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEVOL-ABK was a gift from Andrea Musacchio (Addgene plasmid # 126035 ; http://n2t.net/addgene:126035 ; RRID:Addgene_126035) -
For your References section:
Mechanism of centromere recruitment of the CENP-A chaperone HJURP and its implications for centromere licensing. Pan D, Walstein K, Take A, Bier D, Kaiser N, Musacchio A. Nat Commun. 2019 Sep 6;10(1):4046. doi: 10.1038/s41467-019-12019-6. 10.1038/s41467-019-12019-6 PubMed 31492860