pLSU4mg10
(Plasmid
#126079)
-
PurposePlant transformation vector for stable expression of mitochondria targeted GFP1-10 in plant cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126079 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLSU4
-
Backbone manufacturerLee et al., 2012
- Backbone size w/o insert (bp) 5379
-
Vector typePlant Expression ; Binary
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemitochondria Rieske iron sulphur protein (1-100 aa)
-
Alt namemtRi
-
SpeciesSolanum tuberosum
-
Insert Size (bp)969
-
GenBank IDX79332.1
- Promoter 'long' CaMV35S
-
Tag
/ Fusion Protein
- GFP1-10 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer ATGACGCACAATCCCACTATCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLSU4mg10 was a gift from Ralf-Bernd Klösgen (Addgene plasmid # 126079 ; http://n2t.net/addgene:126079 ; RRID:Addgene_126079) -
For your References section:
Targeting specificity of nuclear-encoded organelle proteins with a self-assembling split-fluorescent protein toolkit. Sharma M, Kretschmer C, Lampe C, Stuttmann J, Klosgen RB. J Cell Sci. 2019 Jun 3;132(11). pii: jcs.230839. doi: 10.1242/jcs.230839. 10.1242/jcs.230839 PubMed 31085714