Skip to main content

pAAV/L7-6-GFP-WPRE
(Plasmid #126462)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126462 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 7914
  • Total vector size (bp) 5758
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    L7-6, Purkinje cell specific promoter
  • Alt name
    pcp2 promoter
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    844

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer L7-6-rev, GGGGAGGGGGAGCAGATATC
  • 3′ sequencing primer GFP-rev, ACTTGTGGCCGTTTACGTCGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The gene origin of L7-6 promoter is L7-4 promoter that is described in the paper (Nitta et al, 2017).
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the Addgene verified sequence contains a truncated ITR compared to the depositor's reference sequence. This truncation was present in the original stock and still worked well for AAV packaging.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV/L7-6-GFP-WPRE was a gift from Hirokazu Hirai (Addgene plasmid # 126462 ; http://n2t.net/addgene:126462 ; RRID:Addgene_126462)
  • For your References section:

    Minimal Purkinje Cell-Specific PCP2/L7 Promoter Virally Available for Rodents and Non-human Primates. Nitta K, Matsuzaki Y, Konno A, Hirai H. Mol Ther Methods Clin Dev. 2017 Jul 27;6:159-170. doi: 10.1016/j.omtm.2017.07.006. eCollection 2017 Sep 15. S2329-0501(17)30089-X [pii] PubMed 28828391