-
Purpose(Empty Backbone) High-copy number vector for the co-expression of two genes in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126475 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMVTNT
-
Backbone manufacturerPromega
- Backbone size (bp) 4111
-
Modifications to backboneThe promoter, multiple cloning site and termination regions have been replaced with the bidirectional expression cassette of the pBI-CMV1 vector (Clontech)
-
Vector typeMammalian Expression
- Promoter CMV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GGGGTCATTAGTTCATAGCCCATAT
- 3′ sequencing primer CAAAACCGCATCACCATGGTAATAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/669127v1 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-BI was a gift from Bill Hansson (Addgene plasmid # 126475 ; http://n2t.net/addgene:126475 ; RRID:Addgene_126475) -
For your References section:
Optimization of Insect Odorant Receptor Trafficking and Functional Expression Via Transient Transfection in HEK293 Cells. Miazzi F, Hoyer C, Sachse S, Knaden M, Wicher D, Hansson BS, Lavista-Llanos S. Chem Senses. 2019 Oct 26;44(9):673-682. doi: 10.1093/chemse/bjz062. 10.1093/chemse/bjz062 PubMed 31504297