-
PurposeA BRET-based mScarlet-I-LumiLuc fusion for red-shifted bioluminescence emission
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126623 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5446
- Total vector size (bp) 6631
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLumiScarlet
-
SpeciesSynthetic
-
Insert Size (bp)1185
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer ATTTAGGTGACACTATAG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-LumiScarlet was a gift from Huiwang Ai (Addgene plasmid # 126623 ; http://n2t.net/addgene:126623 ; RRID:Addgene_126623) -
For your References section:
ATP-Independent Bioluminescent Reporter Variants To Improve in Vivo Imaging. Yeh HW, Xiong Y, Wu T, Chen M, Ji A, Li X, Ai HW. ACS Chem Biol. 2019 Apr 17. doi: 10.1021/acschembio.9b00150. 10.1021/acschembio.9b00150 PubMed 30969754