Skip to main content

pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP
(Plasmid #126698)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126698 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PX458
  • Backbone manufacturer
    Morrissey Laboratory
  • Backbone size w/o insert (bp) 9186
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting human SCGB3A2 locus
  • gRNA/shRNA sequence
    caccgtcaggaggcgctatcacactgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc
  • Insert Size (bp)
    76
  • Promoter Human U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Morrissey Laboratory

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP was a gift from Darrell Kotton (Addgene plasmid # 126698 ; http://n2t.net/addgene:126698 ; RRID:Addgene_126698)
  • For your References section:

    Single-Cell Transcriptomic Profiling of Pluripotent Stem Cell-Derived SCGB3A2+ Airway Epithelium. McCauley KB, Alysandratos KD, Jacob A, Hawkins F, Caballero IS, Vedaie M, Yang W, Slovik KJ, Morley M, Carraro G, Kook S, Guttentag SH, Stripp BR, Morrisey EE, Kotton DN. Stem Cell Reports. 2018 May 8;10(5):1579-1595. doi: 10.1016/j.stemcr.2018.03.013. Epub 2018 Apr 12. 10.1016/j.stemcr.2018.03.013 PubMed 29657097