Skip to main content

pX330-Flag-HiFi SpCas9 (without sgRNA; with silent mutations)
(Plasmid #126778)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126778 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330-like (without U6-sgRNA coding sequence)
  • Total vector size (bp) 8077
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HiFi SpCas9
  • Species
    S. pyogenes
  • Insert Size (bp)
    4272
  • Mutation
    R691A
  • Promoter CBh
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GATCGGCGACCAGTACGCCG
  • 3′ sequencing primer GGTCCACATCGTAGTCGGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pCbh-3xFLAG-NLS-HiFi SpCas9-NLS (without U6-sgRNA coding sequence, with silent mutations).

The lack of sgRNA expression cassette allows for easy testing of various SpCas9 variants with the same sgRNA expressed from a separate plasmid (e.g. pmCherry_gRNA, Addgene# #80457).

For detailed information and plasmid usage, please see the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-Flag-HiFi SpCas9 (without sgRNA; with silent mutations) was a gift from Ervin Welker (Addgene plasmid # 126778 ; http://n2t.net/addgene:126778 ; RRID:Addgene_126778)
  • For your References section:

    Blackjack mutations improve the on-target activities of increased fidelity variants of SpCas9 with 5'G-extended sgRNAs. Kulcsar PI, Talas A, Toth E, Nyeste A, Ligeti Z, Welker Z, Welker E. Nat Commun. 2020 Mar 6;11(1):1223. doi: 10.1038/s41467-020-15021-5. 10.1038/s41467-020-15021-5 PubMed 32144253