Skip to main content

(SUMO)5-(SIM)10
(Plasmid #126923)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126923 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMal-tev
  • Backbone manufacturer
    NEB
  • Backbone size w/o insert (bp) 6600
  • Total vector size (bp) 9225
  • Modifications to backbone
    tev sites added on either side of the NdeI / BamHI cloning site C-terminal His6 added, HindIII site added after C-terminal His6
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    5 repeats of human SUMO3 and 10 repeats of human SUMO interactive motif (SIM) from PIASx each separated by (GGS)4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2625
  • Mutation
    internal BamHI site between (SUMO)5 and (SIM)10
  • Entrez Gene
    SUMO3 (a.k.a. SMT3A, SMT3H1, SUMO-3, Smt3B)
  • Promoter tac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHi and BglII (destroyed during cloning)
  • 5′ sequencing primer TGCGTACTGCGGTGATCAAC'
  • 3′ sequencing primer GTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    (SUMO)5-(SIM)10 was a gift from Michael Rosen (Addgene plasmid # 126923 ; http://n2t.net/addgene:126923 ; RRID:Addgene_126923)
  • For your References section:

    Compositional Control of Phase-Separated Cellular Bodies. Banani SF, Rice AM, Peeples WB, Lin Y, Jain S, Parker R, Rosen MK. Cell. 2016 Jul 28;166(3):651-663. doi: 10.1016/j.cell.2016.06.010. Epub 2016 Jun 30. 10.1016/j.cell.2016.06.010 PubMed 27374333