px458_2A_GFP_sgRNA_RACK1
(Plasmid
#127123)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127123 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepx458_2A_GFP_sgRNA
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA RACK1
-
gRNA/shRNA sequenceACTGCGGGGTAGTAGCGATC
-
SpeciesH. sapiens (human)
-
Entrez GeneRACK1 (a.k.a. GNB2L1, Gnb2-rs1, H12.3, HLC-7, PIG21)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px458_2A_GFP_sgRNA_RACK1 was a gift from Thomas Tuschl (Addgene plasmid # 127123 ; http://n2t.net/addgene:127123 ; RRID:Addgene_127123) -
For your References section:
The G3BP1-Family-USP10 Deubiquitinase Complex Rescues Ubiquitinated 40S Subunits of Ribosomes Stalled in Translation from Lysosomal Degradation. Meyer C, Garzia A, Morozov P, Molina H, Tuschl T. Mol Cell. 2020 Mar 19;77(6):1193-1205.e5. doi: 10.1016/j.molcel.2019.12.024. Epub 2020 Jan 24. 10.1016/j.molcel.2019.12.024 PubMed 31981475