Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRSFDuet-sumo-h-cGAS
(Plasmid #127161)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 127161 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRSFDuet
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 4114
  • Total vector size (bp) 5685
  • Modifications to backbone
    His-SUMO tag added to MCS1
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    MB21D1
  • Alt name
    Cgas
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5685
  • Mutation
    None
  • GenBank ID
    NM_138441.2
  • Entrez Gene
    CGAS (a.k.a. C6orf150, D4, MB21D1, h-cGAS)
  • Tag / Fusion Protein
    • His-SUMO tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer GTATTAGAATCCAAGCTGATCAG
  • 3′ sequencing primer T7 terminator
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSFDuet-sumo-h-cGAS was a gift from Thomas Tuschl (Addgene plasmid # 127161 ; http://n2t.net/addgene:127161 ; RRID:Addgene_127161)
  • For your References section:

    Development of human cGAS-specific small-molecule inhibitors for repression of dsDNA-triggered interferon expression. Lama L, Adura C, Xie W, Tomita D, Kamei T, Kuryavyi V, Gogakos T, Steinberg JI, Miller M, Ramos-Espiritu L, Asano Y, Hashizume S, Aida J, Imaeda T, Okamoto R, Jennings AJ, Michino M, Kuroita T, Stamford A, Gao P, Meinke P, Glickman JF, Patel DJ, Tuschl T. Nat Commun. 2019 May 21;10(1):2261. doi: 10.1038/s41467-019-08620-4. 10.1038/s41467-019-08620-4 PubMed 31113940