Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #127162)


Item Catalog # Description Quantity Price (USD)
Plasmid 127162 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4114
  • Total vector size (bp) 5028
  • Modifications to backbone
    His-SUMO tag added to MCS1
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
  • GenBank ID
  • Entrez Gene
    CGAS (a.k.a. C6orf150, MB21D1, h-cGAS)
  • Tag / Fusion Protein
    • His-SUMO tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer GTATTAGAATCCAAGCTGATCAG
  • 3′ sequencing primer T7 terminator
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSFDuet-sumo-h-cGASCD(K427E/K428E) was a gift from Thomas Tuschl (Addgene plasmid # 127162 ; ; RRID:Addgene_127162)
  • For your References section:

    Development of human cGAS-specific small-molecule inhibitors for repression of dsDNA-triggered interferon expression. Lama L, Adura C, Xie W, Tomita D, Kamei T, Kuryavyi V, Gogakos T, Steinberg JI, Miller M, Ramos-Espiritu L, Asano Y, Hashizume S, Aida J, Imaeda T, Okamoto R, Jennings AJ, Michino M, Kuroita T, Stamford A, Gao P, Meinke P, Glickman JF, Patel DJ, Tuschl T. Nat Commun. 2019 May 21;10(1):2261. doi: 10.1038/s41467-019-08620-4. 10.1038/s41467-019-08620-4 PubMed 31113940