pRSFDuet-sumo-h-cGASCD(K427E/K428E)
(Plasmid
#127162)
-
Purposeexpression of truncated human cGAS protein
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127162 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRSFDuet
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 4114
- Total vector size (bp) 5028
-
Modifications to backboneHis-SUMO tag added to MCS1
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMB21D1
-
Alt nameCgas
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5028
-
MutationNone
-
GenBank IDNM_138441.2
-
Entrez GeneCGAS (a.k.a. C6orf150, D4, MB21D1, h-cGAS)
-
Tag
/ Fusion Protein
- His-SUMO tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer GTATTAGAATCCAAGCTGATCAG
- 3′ sequencing primer T7 terminator
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSFDuet-sumo-h-cGASCD(K427E/K428E) was a gift from Thomas Tuschl (Addgene plasmid # 127162 ; http://n2t.net/addgene:127162 ; RRID:Addgene_127162) -
For your References section:
Development of human cGAS-specific small-molecule inhibitors for repression of dsDNA-triggered interferon expression. Lama L, Adura C, Xie W, Tomita D, Kamei T, Kuryavyi V, Gogakos T, Steinberg JI, Miller M, Ramos-Espiritu L, Asano Y, Hashizume S, Aida J, Imaeda T, Okamoto R, Jennings AJ, Michino M, Kuroita T, Stamford A, Gao P, Meinke P, Glickman JF, Patel DJ, Tuschl T. Nat Commun. 2019 May 21;10(1):2261. doi: 10.1038/s41467-019-08620-4. 10.1038/s41467-019-08620-4 PubMed 31113940