Skip to main content

LentiGuide-BC-EF1a-Puro
(Plasmid #127170)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127170 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti (Addgene #61427)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None
  • Promoter EF1a

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer CCACATAGCGTAAAAGGAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Cloning Method: Golden Gate; Cloning Site 3-prime: CCACATAGCGTAAAAGGAGC

Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiGuide-BC-EF1a-Puro was a gift from Paul Blainey (Addgene plasmid # 127170 ; http://n2t.net/addgene:127170 ; RRID:Addgene_127170)
  • For your References section:

    Optical Pooled Screens in Human Cells. Feldman D, Singh A, Schmid-Burgk JL, Carlson RJ, Mezger A, Garrity AJ, Zhang F, Blainey PC. Cell. 2019 Oct 17;179(3):787-799.e17. doi: 10.1016/j.cell.2019.09.016. 10.1016/j.cell.2019.09.016 PubMed 31626775