Skip to main content

Cdk12_intron3_sg2_pX330
(Plasmid #127174)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127174 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330
  • Backbone manufacturer
    Feng Zhang Lab (Addgene Plasmid #42230)
  • Backbone size w/o insert (bp) 8484
  • Total vector size (bp) 8509
  • Modifications to backbone
    gRNA sequence provided cloned into pX330 using modified version of protocol published in https://www.nature.com/articles/nprot.2013.143
  • Vector type
    Mouse Targeting, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Mouse Cdk12 Intron 3 sgRNA
  • gRNA/shRNA sequence
    TCGAGGCCAGCCTAGTCTAG
  • Species
    M. musculus (mouse)
  • Promoter U6 Promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer LKO.1 5' primer (gactatcatatgcttaccgt)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cdk12_intron3_sg2_pX330 was a gift from Phil Sharp (Addgene plasmid # 127174 ; http://n2t.net/addgene:127174 ; RRID:Addgene_127174)
  • For your References section:

    CDK12 regulates DNA repair genes by suppressing intronic polyadenylation. Dubbury SJ, Boutz PL, Sharp PA. Nature. 2018 Dec;564(7734):141-145. doi: 10.1038/s41586-018-0758-y. Epub 2018 Nov 28. 10.1038/s41586-018-0758-y PubMed 30487607