Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #127174)


Item Catalog # Description Quantity Price (USD)
Plasmid 127174 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Feng Zhang Lab (Addgene Plasmid #42230)
  • Backbone size w/o insert (bp) 8484
  • Total vector size (bp) 8509
  • Modifications to backbone
    gRNA sequence provided cloned into pX330 using modified version of protocol published in
  • Vector type
    Mouse Targeting, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    Mouse Cdk12 Intron 3 sgRNA
  • gRNA/shRNA sequence
  • Species
    M. musculus (mouse)
  • Promoter U6 Promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer LKO.1 5' primer (gactatcatatgcttaccgt)
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cdk12_intron3_sg2_pX330 was a gift from Phil Sharp (Addgene plasmid # 127174 ; ; RRID:Addgene_127174)
  • For your References section:

    CDK12 regulates DNA repair genes by suppressing intronic polyadenylation. Dubbury SJ, Boutz PL, Sharp PA. Nature. 2018 Dec;564(7734):141-145. doi: 10.1038/s41586-018-0758-y. Epub 2018 Nov 28. 10.1038/s41586-018-0758-y PubMed 30487607