-
PurposePiggybac transposon plasmid with CAG promoter GFP-Galectin 8 (GFP-Gal8) fusion protein. Useful as genetically encoded endosomal escape sensor.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127191 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePB-CAG-GAPd2
- Backbone size w/o insert (bp) 6466
- Total vector size (bp) 7422
-
Modifications to backboneIn-frame insertion of Gal8 to form c-terminus fusion protein with GFP
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP-Gal8
-
Alt nameGalectin-8
-
Alt nameGFP
-
Alt nameLGALS8
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2135
-
GenBank ID3964
-
Entrez GeneLGALS8 (a.k.a. Gal-8, PCTA-1, PCTA1, Po66-CBP)
- Promoter CMV
-
Tag
/ Fusion Protein
- Gal8 is fused to the c-terminus of GFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer AAGATCTCAGTGGTATTTGTGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-GFP-Gal8 was a gift from Jordan Green (Addgene plasmid # 127191 ; http://n2t.net/addgene:127191 ; RRID:Addgene_127191) -
For your References section:
Carboxylated branched poly(beta-amino ester) nanoparticles enable robust cytosolic protein delivery and CRISPR-Cas9 gene editing. Rui Y, Wilson DR, Choi J, Varanasi M, Sanders K, Karlsson J, Lim M, Green JJ. Sci Adv. 2019 Dec 6;5(12):eaay3255. doi: 10.1126/sciadv.aay3255. eCollection 2019 Dec. 10.1126/sciadv.aay3255 PubMed 31840076