Skip to main content

pGTRm
(Plasmid #127197)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127197 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pB322
  • Backbone size w/o insert (bp) 2300
  • Total vector size (bp) 2699
  • Vector type
    Template plasmid for generation of Golden Gate PCR amplicons

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tRNA-gRNA PCR template
  • gRNA/shRNA sequence
    -
  • Promoter None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer CAGGGTTATTGTCTCATGAGCGGA
  • 3′ sequencing primer CCTGTGTGAAATTGTTATCCGCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGTRm was a gift from Jordan Green (Addgene plasmid # 127197 ; http://n2t.net/addgene:127197 ; RRID:Addgene_127197)
  • For your References section:

    Poly(Beta-Amino Ester) Nanoparticles Enable Nonviral Delivery of CRISPR-Cas9 Plasmids for Gene Knockout and Gene Deletion. Rui Y, Varanasi M, Mendes S, Yamagata HM, Wilson DR, Green JJ. Mol Ther Nucleic Acids. 2020 Apr 21;20:661-672. doi: 10.1016/j.omtn.2020.04.005. 10.1016/j.omtn.2020.04.005 PubMed 32380416