Skip to main content
Addgene

pAAV-CaMKIIa-ChRger2-TS-EYFP
(Plasmid #127238)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127238 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5076
  • Total vector size (bp) 6930
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Please use Rec A- competent cells such as Stbl3 cells from Invitrogen for transformation.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ChRger2-TS-EYFP
  • Insert Size (bp)
    1854
  • Promoter CamKIIa
  • Tags / Fusion Proteins
    • EYFP (C terminal on insert)
    • SpyTag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer cgggggatccgccaccATG
  • 3′ sequencing primer atatcgaattcttattacttgtacagctcgtccatgcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKIIa-ChRger2-TS-EYFP was a gift from Viviana Gradinaru (Addgene plasmid # 127238 ; http://n2t.net/addgene:127238 ; RRID:Addgene_127238)
  • For your References section:

    Machine learning-guided channelrhodopsin engineering enables minimally invasive optogenetics. Bedbrook CN, Yang KK, Robinson JE, Mackey ED, Gradinaru V, Arnold FH. Nat Methods. 2019 Oct 14. pii: 10.1038/s41592-019-0583-8. doi: 10.1038/s41592-019-0583-8. 10.1038/s41592-019-0583-8 PubMed 31611694