-
PurposeFluorescent reporter for calmodulin 1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127393 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCustomized Vector
- Total vector size (bp) 5930
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCalmodulin 1
-
Alt nameCalm1
-
Alt nameCaM
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_009790.5
-
Entrez GeneCalm1 (a.k.a. CaM, Calm, Cam1)
- Promoter pCAG
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTCCCACAACGAGGACTAC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-mCherry-CaM was a gift from Ryohei Yasuda (Addgene plasmid # 127393 ; http://n2t.net/addgene:127393 ; RRID:Addgene_127393) -
For your References section:
Mechanisms of Ca(2+)/calmodulin-dependent kinase II activation in single dendritic spines. Chang JY, Nakahata Y, Hayano Y, Yasuda R. Nat Commun. 2019 Jun 25;10(1):2784. doi: 10.1038/s41467-019-10694-z. 10.1038/s41467-019-10694-z PubMed 31239443