pFUGW Cas9-BFP
(Plasmid
#127396)
-
PurposeCas9 expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127396 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFUGW
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9
-
Insert Size (bp)5000
- Promoter SVVF
-
Tag
/ Fusion Protein
- BFP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGTCCTCCGACAGACTGAGTC
- 3′ sequencing primer CATTAAAGCAGCGTATCCACATAGCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUGW Cas9-BFP was a gift from Xiaowei Zhuang (Addgene plasmid # 127396 ; http://n2t.net/addgene:127396 ; RRID:Addgene_127396) -
For your References section:
Imaging-based pooled CRISPR screening reveals regulators of lncRNA localization. Wang C, Lu T, Emanuel G, Babcock HP, Zhuang X. Proc Natl Acad Sci U S A. 2019 May 28;116(22):10842-10851. doi: 10.1073/pnas.1903808116. Epub 2019 May 13. 10.1073/pnas.1903808116 PubMed 31085639