Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pEVOL-AcKRS-CloDF
(Plasmid #127415)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 127415 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEVOL
  • Modifications to backbone
    Replication of origin is CloDF.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Pyrrolysyl-tRNA synthetase/pyrrolysyl -tRNA pair
  • Alt name
    PylRS/Pyl-tRNA
  • Species
    Methanosarcina mazei
  • Promoter araBAD

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer CAATTTAGCGTTTGAAAGCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEVOL-AcKRS-CloDF was a gift from Wenshe Liu (Addgene plasmid # 127415 ; http://n2t.net/addgene:127415 ; RRID:Addgene_127415)
  • For your References section:

    A Genetically Encoded, Phage-Displayed Cyclic-Peptide Library. Wang XS, Chen PC, Hampton JT, Tharp JM, Reed CA, Das SK, Wang DS, Hayatshahi HS, Shen Y, Liu J, Liu WR. Angew Chem Int Ed Engl. 2019 Oct 28;58(44):15904-15909. doi: 10.1002/anie.201908713. Epub 2019 Sep 9. 10.1002/anie.201908713 PubMed 31398275