pMega-MaFRSA
(Plasmid #200226)

• Purpose: The plasmid encodes an orthogonal aminoacyl-tRNA synthetase/tRNA-CUA pair for amber codon suppression with meta-trifluoromethylphenylalanine..
• Depositing Lab: Alanna Schepartz
• Publication: Fricke et al Nat Chem. 2023 Jun 1. doi: 10.1038/s41557-023-01224-y.

Backbone

• Vector backbone: pUltra
• Backbone manufacturer: Peter Schultz
• Backbone size w/o insert (bp): 4029
• Total vector size (bp): 4928
• Modifications to backbone: Added a lacO site following the proK promoter to make tRNA expression IPTG-inducible.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Pyrrolysyl-tRNA synthetase
• Alt name: PylRS
• Alt name: pyrrolysine-tRNA(Pyl) ligase
• Species: Candidatus Methanomethylophilus alvus
• Insert Size (bp): 828
• Mutation: mutated Asparagine 166 to Alanine and Valine 168 to Alanine
• GenBank ID: AGI85861.1 WP_015505008
• Promoter: tacI
• Tag / Fusion Protein:
  • none

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGCTGTTGACAATTAATCATCGGCTCG
• 3′ sequencing primer: ggcggatgagagaagattttcagcc

Gene/Insert 2

• Gene/Insert name: pyrrolysyl-tRNA
• Alt name: tRNA-Pyl
• Alt name: PylT
• Species: Candidatus Methanomethylophilus alvus
• Insert Size (bp): 71
• Mutation: none
• GenBank ID: LR699000.1 CP017686.1
• Promoter: proK-lacO
• Tag / Fusion Protein:
  • none

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TGTGCTTCTCAAATGCCTGAGGC
• 3′ sequencing primer: cctcaggcatttgagaagcacacg

Resource Information

• Supplemental Documents:
  • pmega-mafrsa-mapylt-tag.gb
• A portion of this plasmid was derived from a plasmid made by: We obtained the original pUltra backbone from Prof. Abhishek Chatterjee who originally designed the plasmid while a post-doc with Pete Schultz. We inserted the genes through Gibson assembly with a synthetic DNA fragment (gblock).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry