Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMega-MaPylRS
(Plasmid #200225)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 200225 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUltra
  • Backbone manufacturer
    Peter Schultz
  • Backbone size w/o insert (bp) 4029
  • Total vector size (bp) 4928
  • Modifications to backbone
    Added a lacO site following the proK promoter to make tRNA expression IPTG-inducible.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Pyrrolysyl-tRNA synthetase
  • Alt name
    PylRS
  • Alt name
    pyrrolysine-tRNA(Pyl) ligase
  • Species
    Candidatus Methanomethylophilus alvus
  • Insert Size (bp)
    827
  • Mutation
    none
  • GenBank ID
    AGI85861.1 WP_015505008
  • Promoter tacI
  • Tag / Fusion Protein
    • none

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGCTGTTGACAATTAATCATCGGCTCG
  • 3′ sequencing primer ggcggatgagagaagattttcagcc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    pyrrolysyl-tRNA
  • Alt name
    tRNA-Pyl
  • Alt name
    PylT
  • Species
    Candidatus Methanomethylophilus alvus
  • Insert Size (bp)
    71
  • Mutation
    none
  • GenBank ID
    LR699000.1 CP017686.1
  • Promoter proK-lacO
  • Tag / Fusion Protein
    • none

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGTGCTTCTCAAATGCCTGAGGC
  • 3′ sequencing primer cctcaggcatttgagaagcacacg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    We obtained the original pUltra backbone from Prof. Abhishek Chatterjee who originally designed the plasmid while a post-doc with Pete Schultz. We inserted the genes through Gibson assembly with a synthetic DNA fragment (gblock).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMega-MaPylRS was a gift from Alanna Schepartz (Addgene plasmid # 200225 ; http://n2t.net/addgene:200225 ; RRID:Addgene_200225)
  • For your References section:

    Expanding the substrate scope of pyrrolysyl-transfer RNA synthetase enzymes to include non-alpha-amino acids in vitro and in vivo. Fricke R, Swenson CV, Roe LT, Hamlish NX, Shah B, Zhang Z, Ficaretta E, Ad O, Smaga S, Gee CL, Chatterjee A, Schepartz A. Nat Chem. 2023 Jun 1. doi: 10.1038/s41557-023-01224-y. 10.1038/s41557-023-01224-y PubMed 37264106