Skip to main content

pEVOL-AckRS
(Plasmid #137976)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 137976 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pEVOL
  • Total vector size (bp) 5651
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AckRS and pylTcua
  • Species
    Methanosarcina mazei
  • Insert Size (bp)
    1365
  • Promoter araBAD

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer tttcagatgggttctggctgcacccgtg
  • 3′ sequencing primer aaagttcagcatagtgaactcttcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEVOL-AckRS was a gift from Wenshe Liu (Addgene plasmid # 137976 ; http://n2t.net/addgene:137976 ; RRID:Addgene_137976)
  • For your References section:

    A Click Chemistry Approach Reveals the Chromatin-Dependent Histone H3K36 Deacylase Nature of SIRT7. Wang WW, Angulo-Ibanez M, Lyu J, Kurra Y, Tong Z, Wu B, Zhang L, Sharma V, Zhou J, Lin H, Gao YQ, Li W, Chua KF, Liu WR. J Am Chem Soc. 2019 Feb 13;141(6):2462-2473. doi: 10.1021/jacs.8b12083. Epub 2019 Feb 4. 10.1021/jacs.8b12083 PubMed 30653310