Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pEvol-MjaYRS
(Plasmid #153557)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 153557 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEvol
  • Total vector size (bp) 6125
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    MJaYRS (first copy)
  • Alt name
    3-amino-tyrosine synthetase derived from archea Methanococcus jannaschii
  • Species
    archea Methanococcus jannaschii
  • Insert Size (bp)
    921
  • GenBank ID
  • Promoter pBAD

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    MJaYRS (second copy)
  • Alt name
    3-amino-tyrosine synthetase derived from archea Methanococcus jannaschii
  • Promoter glnS

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer CGAGAGTAGGGAACTGCCAG
  • 3′ sequencing primer CGCTGAACGCGGCGTTTTGG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    amber suppression tRNA under proK promoter
  • Species
    Synthetic

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Our further research identified that the unwanted oxidation of 3-amino-L-tyrosine by oxygen in the air might cause variations in incorporation efficiency, resulting in green impurities. Best results were obtained by using a medium volume equal to ~1/5 of the container marked volume (i.e. 100 mL for a 500-mL flask), inducing the expression and adding 4 mM 3-amino-L-tyrosine at OD600=1.2, and then sealing the flask for shaking at 30C for additional 48 h. In addition, an E222H mutation to sfGFP can significantly increase the brightness of the red fluorescence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEvol-MjaYRS was a gift from Huiwang Ai (Addgene plasmid # 153557 ; http://n2t.net/addgene:153557 ; RRID:Addgene_153557)
  • For your References section:

    A general strategy to red-shift green fluorescent protein-based biosensors. Zhang S, Ai HW. Nat Chem Biol. 2020 Sep 14. pii: 10.1038/s41589-020-0641-7. doi: 10.1038/s41589-020-0641-7. 10.1038/s41589-020-0641-7 PubMed 32929278